KARLIJN SIBBEL UPDATE 5/5

“Fundamentally, biology is a manufacturing technology – Biology is all about making more of something. Converting one substance into another. In many cases it is converting food into more food by making copies of itself.”

Tom Knight (Technologist) tijdens het World Science Festival in New York :  It’s Alive, But Is It Life: Synthetic Biology and the Future of Creation.

“I don’t want to industrialize biology, I want to biologize the industry.”

Drew Endy (Synthetic Biologist) tijdens het World Science Festival in New York :  It’s Alive, But Is It Life: Synthetic Biology and the Future of Creation.

Genspace onderzoek

In mijn werk zoek ik naar hoe we de natuur kunnen gebruiken om design en het fabriceren van objecten en producten te veranderen. Daarvoor richt ik mij op manieren om de groei van natuurlijke materialen te sturen. Tijdens mijn onderzoek hier in het lab van Genspace (zie ook vorige blog), ben ik verschillende bio-materialen* aan het groeien om meer inzicht te krijgen in de omstandigheden die deze organismen nodig hebben om te kunnen groeien en materialen te formeren. Vervolgens ben ik verschillende manieren aan het uitproberen om deze omstandigheden te sturen. Een voorbeeld van zo’n materiaal dat ik bij Genspace laat groeien, is bacteriële cellulose. Bacteriële cellulose wordt onder andere geproduceerd in een Kombucha fermentatie (manier om Kombucha thee te maken) waarin een samenlevingsvorm van een bacterie en een gist, een cellulose laag op de oppervlakte van de vloeibare cultuur creëert. Nu ben ik op verschillende manieren aan het experimenteren hoe ik deze groei-eigenschap kan beïnvloeden om onder andere patroonvorming in het materiaal te groeien en verschillende diktes kan laten ontstaan. Naast bacteriële cellulose groei ik verschillende soorten macro- en micro algen (zeewier en eencellige algen) en mycelium (draadnetwerk van een schimmel).
*Een bio-materiaal verwijst naar een materiaal dat afkomstig is van een levend organisme.

Onderzoek Genspace - bacteriele cellulose - Karlijn Sibbel Onderzoek Genspace - Study pattern formation - Karlijn Sibbel
Genspace onderzoek - algen culturen - Karlijn Sibbel Genspace onderzoek - reguleren groei kombucha - Karlijn Sibbel
Genspace onderzoek - micro-algen - Karlijn Sibbel Genspace onderzoek- gedroogde Cellulose - Karlijn Sibbel
Als Alumni Product Design heb ik vaardigheden ontwikkeld om in een hout, keramiek, metaal, textiel en kunststofwerkplaats te werken, maar het groeien van materiaal vraagt om een andere werkplaats met andere vaardigheden. Tot nu toe heb ik door het werken bij Genspace al enorm veel geleerd over het werken met verschillende instrumentaria en protocollen die van belang zijn in mijn onderzoek.

Genspace is een community lab waardoor ik veel verschillende mensen ontmoet die op hun eigen manier gebruik maken van het lab. Van engineers, entrepreneurs, studenten tot zakenlui. Omdat Genspace een platform vormt waar iedereen kan werken, is er een enorme diversiteit aan leden met totaal verschillende achtergronden. De grote overeenkomst tussen al deze leden is hun enorme fascinatie voor synthetische biologie*.  Het is enorm inspirerend om tussen zo veel uiteenlopende mensen te werken en daardoor constant verschillende inputs te krijgen. Zo zie ik Michael Flanagen bijna iedere dag. Toen hij 18 was, werkte hij voor een zomer in Hilversum waar hij besloot om engineer te worden. Daarna werkte hij onder andere voor NASA en verschillende start-up bedrijven. Hij was een ‘electrical engineer’ maar is daarmee gestopt en heeft zich bij Genspace ontwikkeld tot een gepassioneerde ‘synthetic biologist’* die zijn eigen onderzoek doet. Van het programmeren van computer code naar het programmeren van DNA code.

Samenwerken met Micheal Flanagen - Genspace - Karlijn Sibbel

Micheal was ook mijn docent voor de ‘Biohacker Bootcamp’ die ik in het begin van mijn verblijf in New York heb gevolgd. In deze workshop leerde ik door combinatie van praktijk en theorie hoe het DNA als ingenieuze opslagmachine werkt, hoe deze DNA codes worden omgezet in materie (proteïnen) en hoe we deze kennis kunnen gebruiken om de genetische samenstelling te manipuleren. In de workshop hebben we geleerd hoe we E. colli bacteriën** kunnen manipuleren om een rood pigment aan te maken en hebben we een deel van ons DNA gekopieerd en laten sequencen***. Door deze codes vervolgens op internet in te voeren konden we achterhalen waar onze voorouders vandaan komen. Zo bleek uit mijn DNA dat ik van mijn moeders kant waarschijnlijk afstamt van de Vikingen die zich rondom Ierland bevonden.
*Synthetische biologie is een onderzoeksveld dat zich richt op het veranderen van bestaande organismen om nuttige functies te verkrijgen en kunstmatige genen en complete biologische systemen te ontwerpen.
** E. colli bacteriën zijn snel groeiende bacteriën die onder andere in ons verteringsstelsel leven om ons lichaam te  helpen ons voedsel af te breken.
*** het lezen van de basenvolgorde (code) van DNA (ATCG)

Fractie van mijn DNA code
GCAGATTTGGGTACCACCCAAGTATTGACTTACCC

Central Park - from the top of the Rock - Karlijn Sibbel Biohacker bootcamp - Karlijn Sibbel - GenspaceBrooklyn Grange Farm - Navy Yard - Karlijn Sibbel Biohacker bootcamp - Karlijn Sibbel - Genspace2

INTRO

Terwijl ik deze laatste blogpost schrijf heb ik uitzicht over de groene bergen en natuur die New York City omringen. Ik bevind mij in een bus naar Boston en Cambridge Massachusetts*. Een vier uur durende busreis waarin ik zie hoe de Amerikaanse steden New York en Boston aan elkaar worden verbonden door langgerekte stukken natuur.  Het is een groot contrast met het bruisende New York, om zo de stad uit te rijden en in een groen berglandschap te belanden. Het contrast tussen natuur en stad is veel terug te zien in New York, alleen al als je kijkt naar de strakke kaders waarin Central Park zich bevindt, maar tegelijkertijd zijn deze grenzen op sommige plekken ook aan het versmelten. Omdat New York zo’n intense dichtheid heeft, worden ze gedwongen creatief om te gaan met de indeling van ruimte. Zo gebruiken ze daken voor tuinen en agricultuur(Brooklyn Grange), hebben ze een park boven de weg (high line) en zijn ze parken aan het ontwikkelen die zich onder de grond kunnen bevinden door zonlicht naar binnen te geleiden (lowline lab).
Highline - Karlijn Sibbel  Lowline lab - Karlijn Sibbel
Na zo’n 70 dagen New York heb ik ontzettend veel geleerd, mensen ontmoet, cursussen gevolgd, studio’s en musea bezocht, onderzoek gedaan en heb ik veel te veel om aan je te vertellen. Via deze laatste blogpost wil ik je inspireren en een klein beetje meer inzicht geven in wat ik hier beleef, leer en zie.
*Lees verderop meer over mijn trip naar Cambridge en Boston.

Biodesign New York

Tijdens mijn verblijf in New York ben ik onder andere dit veld van design aan het onderzoeken, waarin we steden, producten en nieuwe applicaties groeien. Hoe we van het groeien van voedsel veranderen naar het groeien van omgevingen. Welke nieuwe grenzen er ontstaan als we natuur en groei gebruiken om te produceren. Om meer inzicht in dit gebied te krijgen ben ik verschillende studio’s, universiteiten, bedrijven en lezingen gaan bezoeken. Een mooi voorbeeld hiervan is Amanda Phingbodhipakkiya. Haar heb ik ontmoet in het TED office in New York. Amanda is Alumni ‘Communication Design’ van PRATT Institute in New York, neurowetenschapper en resident bij TED. Tijdens haar TED residentie heeft ze in haar project, The Leading Strand, verschillende neurowetenschappers aan designers gekoppeld om op een gelijkwaardige manier samen te werken. Hierin visualiseren de designers het onderzoek van deze neurowetenschappers waardoor deze wetenschap toegankelijk wordt voor iedereen. Zij onderzoekt hoe ontwerpers kunnen helpen om wetenschappelijk onderzoek te communiceren.

Een ander voorbeeld is het Bio-Art Lab opgezet door Suzanne Anker op de School for Visual Arts (SVA) in New York. In de SVA is dit bio-lab gevestigd waar (voornamelijk Fine Art) studenten van gebruik kunnen maken. Ze bestuderen verschillende organismen zoals planten, insecten en zeedieren, kweken hun eigen materialen en kunnen gebruik maken van technieken om genetische informatie te manipuleren. Net als met Genspace hebben deze voorbeelden overeen dat ze wetenschap toegankelijk maken voor een breder publiek. Amanda laat ontwerpers neurowetenschappelijk onderzoek omzetten naar visuele media waardoor veel meer mensen inzicht kunnen krijgen in deze wetenschap. Het Bio-Art Lab maakt biologie toegankelijk voor Fine Art studenten die deze kennis vervolgens kunnen gebruiken in hun werk en naar een breder publiek kunnen communiceren. En Genspace is een laboratorium waar iedereen lid van kan worden, lezingen en workshops kan volgen en gebruik kan maken van hun middelen waardoor de biotechnologische wetenschap toegankelijk wordt voor een groot publiek.

SVA - gekloonde planten - Karlijn Sibbel SVA Bio-Artlab - Karlijn Sibbel SVA Bio-Art-Lab NY - Karlijn Sibbel

Ik denk dat het belangrijk is dat wetenschap op deze manieren toegankelijker en begrijpelijker wordt gemaakt. Soms schrikken mensen af van de wetenschap, als ze bijvoorbeeld een formule zien die ze niet begrijpen. Het kan mensen het gevoel geven dat de wetenschap ver van hen af staat en onbereikbaar is. Terwijl dat helemaal niet zo hoeft te zijn, een formule is een manier van communiceren. Het niet begrijpen van iets kan angst creëren, maar er ook voor zorgen dat mensen dingen misvatten of onjuiste kennis aannemen. Mede hierdoor denk ik dat het toegankelijk maken van kennis zoals Amanda dit bijvoorbeeld doet, deze afstand tot de wetenschap meer kan vervagen.

“Een bekend gezegde onder uitgevers is dat elke formule in een boek het aantal lezers halveert.”

– Robbert Dijkgraaf (wiskundige natuurkundige) in zijn boek ‘Het nut van nutteloos onderzoek.’

Maar het toegankelijk maken van dit soort technieken (en in dit geval spreek ik over synthetische biologie (genetisch manipuleren)) zoals Genspace en het Bio-Art Lab op het SVA dit doen en deze technieken in het algemeen, brengen natuurlijk meerdere interessante en ingewikkelde etnische vraagstukken ter discussie. Waar liggen bijvoorbeeld de nieuwe grenzen waarin studio’s en instituten gebruik maken van groei en de natuur en het manipuleren hiervan?

Uiteraard zijn dit geen heldere grenzen. Maar door deze discussies aan te gaan en met veel verschillende mensen hier in New York erover gesproken te hebben, heb ik nieuwe inzichten en een betere beeldvorming gekregen van hoe dit soort vraagstukken en discussies kunnen worden ingekaderd en worden gestimuleerd.

Om twee voorbeelden van dit soort nieuwe inzichten te noemen, sprak ik ten eerste met een labmanager van het Bio-Art Lab. Hij werkt aan manieren om Monsanto* en Kunstenaars samen te brengen om dit soort discussies open te gooien en perspectieven te verbreden. Een ander voorbeeld is George Church, geneticus, die bacteriën door middel van ‘safety engineering’ verslaafd maakt aan specifieke chemicaliën uit het lab zodat deze bacteriën (als ze genetisch gemanipuleerd zijn) niet buiten het lab kunnen overleven en zo de mogelijkheid van besmetting van de buitenwereld kan voorkomen.
* Monsanto is een groot landbouwbedrijf dat onder andere werkt met genetisch gemanipuleerde gewassen – zie ook documentaire Food INC

CAMBRIDGE Massachusetts

Ik vertelde jullie al dat ik dit blog aan het schrijven ben tijdens mijn transfer tussen New York City en Cambridge / Boston Massachusetts. Ondertussen ben ik weer op mijn weg terug naar New York. De achterliggende reden van deze reis heeft een beetje context nodig. In mijn 3e studiejaar op ArtEZ heb ik deelgenomen aan een Masterclass op de Radboud Universiteit Nijmegen genaamd Blikwisseling*  dat werd geleid door Elly Jessop en Peter Torpey van de research groep ‘Opera of the Future’ van het MIT media lab. In Cambridge heb ik Peter Torpey weer ontmoet die mij heeft rondgeleid over het MIT media lab, MIT en Harvard in Cambridge. Het MIT media lab is een tak van het MIT waar verschillende interdisciplinaire research groepen werken. ‘Opera of the Future’ is een research groep dat zich richt op het exploreren van concepten en technieken die de toekomst van muzikale composities, performance, educatie en expressie veranderen. Hiervoor ontwikkelen ze onder andere ‘hyperinstruments’, instrumenten waarvan de output wordt getransformeerd door computerbesturing. Tijdens mijn bezoek heeft Peter mij ook geïntroduceerd aan een aantal mensen van de ‘Mediated Matter’ groep omdat mijn visie en manier van werken veel met hun overeenkomt. De ‘Mediated Matter’ groep focust zich op hoe digitale- en fabricatie technieken overeenstemmen met materie en zijn omgeving om design en het construeren van objecten, gebouwen en systemen radicaal te transformeren. Hiervoor wijden ze zich aan het ontwikkelen en toepassen van nieuwe processen, door zowel computergestuurde strategieën als biologisch geïnspireerde fabricatie te integreren. Heel inspirerend om met deze groep mensen in contact te komen, te zien aan wat voor projecten en op welke manieren al deze verschillende research groepen in het Media Lab werken. In totaal zijn er ongeveer 25 van dit soort uiteenlopende groepen werkzaam.

Wie weet zien zij mij daar nog eens terug…
* lees en bekijk meer over de masterclass op mijn website https://karlijnsibbel.com/portfolio/aurora/

MIT media lab - building - Karlijn Sibbel MIT museum - social robots - Karlijn Sibbel MIT museum - Kismet the robot - Karlijn Sibbel MIT museum - image of discovery photo of the soapbubble machine - Karlijn Sibbel MIT museum - image of discovery photo of the soap bubble machine- Karlijn Sibbel MIT museum - image of discovery photo of playing with the frequency machine - Karlijn Sibbel

Helaas was dit mijn laatste post als huisblogger voor de ArtEZ & Innovatie website, maar wil je mij blijven volgen? Dat kan! Via facebook, instagram en mijn website houd ik je op de hoogte.

Facebooklink: https://www.facebook.com/studiokarlijnsibbel/?fref=ts
Instagram: https://www.instagram.com/karlijnsibbel/
Website: https://karlijnsibbel.com/

More from Karlijn Sibbel

KARLIJN SIBBEL UPDATE 2

Industry by Nature on tour Als ik terugblik op de afgelopen maanden,...
Read More

Geef een reactie

Het e-mailadres wordt niet gepubliceerd. Vereiste velden zijn gemarkeerd met *